Revista Mexicana de Ciencias Agrícolas   volume 9  number 8   November 12 - December 31, 2018

DOI: https://doi.org/10.29312/remexca.v9i8.756

Article

Molecular identification of Fusarium spp. isolated maize in Sinaloa, Mexico

Sixto Velarde Félix1

Nallely Valdez Rubio2

Francisco Zamora Galván3

Ramón López Molina2

Claudia María Melgoza Villagómez4

José Antonio Garzón Tiznado5§

1Experimental Field of Culiacán Valley-INIFAP. Highway Culiacán-Eldorado km 17.5, Culiacán, Sinaloa, Mexico. ZC. 80000. (velarde.sixto@inifap.gob.mx). 2Autonomous University of Sinaloa-Faculty of Agronomy. Highway Culiacán-Eldorado km 17.5, Culiacán, Sinaloa, Mexico. ZC. 80000. (nava-will@hotmail.com; ramon-lm16@hotmail.com). 3Agricultural Technological Baccalaureate Center Num. 247. Tampico Prolongation num. 22, Jala, Nayarit. ZC. 63880. (Francisco-zg15@hotmail.com). 4Experimental Site Valle de Santo Domingo-INIFAP. Transpeninsular Highway km 208, Cd. Constitución, Baja California Sur, Mexico. ZC. 23600. (cmelgozavillagomez@gmail.com). 5Autonomous University of Sinaloa-Faculty of Biological Chemistry Sciences. Av. De Las Américas and Blvd. Universitarios s/n, Culiacán, Sinaloa, Mexico. ZC. 80013.

§Corresponding author: garzon24@hotmail.com.

Abstract

Fusarium species cause macular diseases in the maize that induce rotting of stems, roots and grains of corn and finally the death of the plant. In the present study, the presence and diversity of Fusarium species associated with these damages in Sinaloa was molecularly identified. During the sowing periods in the years 2013-2014, stem and root tissue from young and adult plants, as well as diseased pod kernels, was collected in the municipalities of Ahome, Culiacan and Elota in the state of Sinaloa. In this investigation, species F. verticillioides, F. oxysporum, F. subglutinans, F. equiseti, F. nygamai, F. cf. bullatum and F. andiyazi, were identified by enzymatic sequencing analysis, where F. verticilloides was the most predominant species. Likewise, the presence in Mexico of Fusarium cf. bullatum causing damage to corn.

Keywords: Zea mays L., Fusaria, enzymatic sequencing.

Reception date: October 2018

Acceptance date: November 2018


Introduction

Mexico is the center of origin and diversity of maize (Zea mays L.), which has given rise to a greater number of endemic maize races, wild varieties and genotypes Center for Studies for Change in the Mexican Countryside (Ceecam, 2012). In Latin America, about 220 maize races have been described (Goodman and Bird, 1977), of which 64 have been identified and described mostly for Mexico (Anderson, 1946; Hernández and Alanis, 1970; Sánchez et al., 2000).

Mexican maize races have been grouped, based on morphological, adaptation and genetic characters (isoenzymes) into seven racial groups or complexes (Goodman and Bird, 1977; Sánchez et al., 2000). INIFAP and its predecessors since 1942 have developed and released more than 250 corn varieties and hybrids, which in some cases have not been sufficient and it should be recognized that in general research, from its inception, has privileged agriculture with the greatest productive potential (Espinosa et al., 2009). The cultivation of corn occupied the first place by area planted in Mexico with 7.6 million hectares, and a total production of 19 504 050 t (SIAP, 2015).

All the entities of the country present some level of production of this crop; however, seven concentrate 64.5% of the volume, being the state of Sinaloa the main producer with 20.7% in a harvested area of 359 400 ha (SIAP, 2015). Among the most economically important diseases are those caused by the genus Fusarium sp. (Hernández et al., 2016) since it is a microorganism with a great diversity of species, special forms and races, associated with plant diseases (Leslie and Summerell, 2006). The phytopathogenic species of this genus constitute a group of filamentous fungi that are widely distributed in the soil and that colonize the aerial and subterranean parts of a wide range of plant species, generating symptoms of yellowness, wilting, root rot, cankers and finally the death of many crops (Leslie and Summerell, 2006).

In several countries, a great diversity of Fusarium species has been found infecting plants (Mesterhaz et al., 2012). In Mexico, the diversity of Fusarium species that generate decay in commercial and native maize populations has been documented (Morales et al., 2007; García and Martínez, 2010; Leyva et al., 2014; Briones et al., 2015).

In addition to their phytopathogenic behavior, species of the genus Fusarium, in their infection process, synthesize secondary metabolites called mycotoxins, within which have been described those of the zearalenone group, trichothecenes and fumonisins (Eckard et al., 2011), which are high toxicity and that generate human and animal disturbances in health.

There are reports that F. solani (Martius) Apple & Wollenweber emend. Snyder & Hansen (teleomorph= Nectria haematococca (Berkeley & Broome) Samuel & Niberberg), F. oxysporum Schlechten emend. Snyder & Hansen (without sexual reproduction) and F. verticilloides (Saccardo) Nirenberg (formerly called F. moniliforme (teleomorph= Gibberella moniliformis Wineland) are the species that mainly cause harm to humans (Tezcan et al., 2009: de Souza et al., 2014), however, it was recently diagnosed with F. subglutinans Wollenber & Reiking Nelson, Toussoun & Marasas (teleomorph= Gibberella subglutinans Nelson, Toussoun & Marasas (Campos et al., 2013) and F. napiforme Marasas, Nelson & Rabie (without sexual reproduction) that cause mycosis in humans (de Souza et al., 2014) and damage grasses (Leslie and Sumerell, 2006).

Fusarium proliferatum (Matsushima) Nirenberg (teleomorph= Gibberella intermedia (Kuhlman) Samuels, Nirenberg & Seifert), F. subglutinans and F. verticillioides are the most well-known species as causal agents of corn root and ear damage worldwide (Bertechini et al., 2012; Kauret al., 2014), in Mexico, F. verticillioides and F. subglutinans (Morales et al., 2007; Figueroa et al., 2010; López et al., 2014) have been the most reported in this disease.

The genus Fusarium is also known for its taxonomic difficulties in the definition and identification of species at the morphological level, hence the relevance of integrating other elements such as pathogenic and molecular characterization that have also proved to be reliable in the evaluation of genetic diversity within this organism (Bacon et al., 1994). Currently molecular biology techniques based on PCR with the use of specific primers and molecular markers have been used for the identification of Fusarium species. The use of the partial gene of calmodulin has been reported for the identification of F. verticillioides, F. proliferatum and F. subglutinans (Mule et al., 2004).

Another alternative is the gene of elongation factor 1 alpha (EF-1α or TEF), which codes for an essential protein of the translation machinery. Its phylogenetic utility lies in the fact that its sequence is highly conserved at the genus Fusarium level, for which primers have been designed that represent a better opportunity to separate species, whose amplified products generate a ~700 bp fragment flanking 3 introns (O’Donell et al., 1998; Geiser et al., 2004). On the other hand, the ITS (Lin et al., 2014), the RAPDs (Kauret al., 2014) and the RFLPs (Hsuan et al., 2010) are also frequently used as molecular tools for the identification of Fusarium species. The objective of the present study was to know the Fusaria species that cause diseases in the cultivation of corn, in sowings of irrigation of the autumn-winter cycle in the state of Sinaloa, Mexico.

Materials and methods

The work was carried out during the spring-summer, autumn-winter 2012-2013 and 2013-2014 agricultural cycles, collecting seedlings, adult plants and corn cobs in different agricultural sites in the municipalities of Ahome, Culiacan and Elota in the state of Sinaloa (Figure 1). The laboratory research was carried out in the Biotechnology Unit of the Valle de Culiacan Experimental Field of the National Institute of Forestry, Agriculture and Livestock Research (INIFAP), 24° 37’ 59.3” north latitude, 107° 26’ 31.0” west longitude 54 meters above sea level, Culiacán, Sinaloa.

Figure 1. Location of the study area.

Isolation of monosporic cultures from Fusaria

Seed tissues of seedlings and maize plants collected were cut into 3 mm longitudinal pieces in addition to grain of corn cobs, which were superficially disinfested with 2% sodium hypochlorite for 2 min and 70% ethanol for 2 min, followed by three consecutive washes with sterile distilled water. For the growth and development of the fungus, the plant tissue was placed in Petri dishes with potato-dextrose-agar culture medium (PDA-Difco) supplemented with 1.5 mL L-1 of PCNB (pentachloronitrobenzene) and cefuroxime (200 mg L-1), incubated at a temperature of 25 °C for five days. The identification of the fungus was carried out in a compound microscope (Olympus Cx31), based on the morphology of the mycelium, microconidia and macroconidia proposed by Leslie and Summerell, (2006).

To obtain monosporic cultures of Fusaria, a small fragment of the mycelium grown in PDA medium was cut out, which contained the fungicide PCNB and cefuroxime, resuspended in 1 mL of sterile distilled water and the number of conidia in serial dilutions was counted by a hematocytometer (Hernández and Rangel, 2011), from these were obtained aliquots that were distributed on PDA medium in Petri dishes, from where the monosporic culture was obtained. The growth of the fungus was observed under the compound microscope, placing individual germinated spores, which were selected and transferred individually to a new Petri dish with PDA medium supplemented with PCNB and cefuroxime. These were incubated under the same conditions mentioned above. A small piece of PDA medium with the developed fungus was transferred to test tubes containing sterile sieved sand (8 x 10 threads cm-3) with Komada liquid medium (Komada, 1975) and stored in a refrigerator at a temperature of 4 °C for its preservation and later use.

Extraction of DNA from monosporic cultures

For DNA extraction, the previously described method was used (Velarde et al., 2015), for which the mushroom mycelium was obtained by scraping with a sterile bacteriological handle from the solid medium, this was placed in porcelain mortar and pistil, previously sterilized for 5 min in a microwave oven household appliance (LG, model MS-1446SQP/01), operating at microwave frequency, around 2.45 GHz (GigaHertz) and finally cooled to -70 ºC. Then, 1 mL of extraction buffer containing: 30 mM NaCl, 30 mM ethylenedinitrilotetraacetic acid (EDTA) and 250 mM Tris Base (pH 8.5) was added, with which it was macerated. The maceration product was placed in 1.5 mL Eppendorf tubes with their respective labeling. Then, 100 L of 10% ammonium cetyltrimethylbromide (CTAB) and 250 L of 5M Sodium Chloride (NaCl) were added to the sample, being incubated at 95 °C for 10 min and subsequently centrifuged at 12 000 rpm for 10 min; After this time, the aqueous solution (supernatant) was transferred to a new tube. A volume of cold chloroform (v/v) was added to the aqueous solution and it was stirred in a vortex unit for a few seconds and then centrifuged at 10 000 rpm for 5 min. After this time, the aqueous solution was transferred to a new tube, adding a volume of cold absolute isopropanol and stirring manually.

Subsequently, the samples were stored for one hour at -20 °C to allow DNA precipitation. After this time, the samples in tubes were centrifuged at 12 000 rpm for 10 min to obtain the DNA pellet, which was allowed to dry at laboratory temperature for two hours, finally, the DNA obtained from the different isolates was resuspended in 50 L of nuclease-free water (Promega) and stored at 4 °C for its conservation.

Analysis by PCR

A group of primer pairs were used for PCR analysis of Fusaria DNA, which were originally described to separate species-specific and in our case, we used them to generate first-hand information for epidemiological studies on the incidence of Fusaria: the pair FOF1/FOR1 for F. oxysporum (Mishra et al., 2003), VER1/2, PRO1/2 and SUB1/2 for species-specific such as Fusarium verticillioides, F. proliferatum and F. subglutinans (Mule et al., 2004) respectively (Table 1). A thermal cycler (Nyx Technik Amplitronyx series 6 A6 (ATC401) Thermal Cycler) was used for the reaction. The final reaction mixture (15 μL) contained 100 ng of DNA, an equimolar mixture of dATP, dCTP, dGTP and dTTP, MgCl2, PCR buffer, DNA Taq polymerase (provided by Promega® PCR Master Mix, Catalog No. M7502), 40 pmoles of each oligonucleotide (Sigma®).

Table 1. Specific initiators, used for the amplification of predicted fragments for Fusaria species.

Initiator’s name

Sequences of initiators 5’→3’

Specific species

SUB1

CTGTCGCTAAACCTCTTTATCCA

F. subglutinans a

SUB2

CAGTATGGACGTTGGTATTATATCTAA

PRO1

CTTTCCGCCAAGTTTCTTC

F. proliferatum a

PRO2

TGTCAGTAACTCGACGTTGTTG

VER1

CTTCCTGCGATGTTTCTCC

F. verticillioides a

VER2

AATTGGCCATTGGTATTATATATCTA

FOF

ACATACCACTTGTTGCCTCG

F. oxysporum b

FOR

CGCCAATCAATTTGAGGAACG

EF1

ATGGGTAAGGA(A/G)GACAAGAC

Fusaria c, d

EF2

GGA(G/A)GTACCAGT(G/C)ATCATGTT

a= Mule et al. (2004); b= Mishra et al. (2003); c= O’Donnell et al. (1998); d= Geiser et al. (2004).

The amplification conditions for F. oxysporum were: 1 cycle at 95 °C, 5 min; 30 cycles (95 ºC, 1 min, 53 ºC, 1 min, 72 ºC, 1 min) and a final extension cycle at 72 ºC, 10 min and 4 ºC, while for F. verticillioides, F. proliferatum and F. subglutinans consisted of: 1 cycle at 95 ºC, 5 min; 30 cycles (95 ºC, 1 min, 56 ºC, 1 min, 72 ºC, 1 min), a final extension cycle at 72 ºC, 10 min and 4 ºC. The amplified products were analyzed on 1% agarose gels, stained with a Gel Red solution (Biotium, catalog No. 41003).

In order to confirm the identity of the species detected with the set of primers described above, a second PCR analysis was performed in which the pair of primers corresponding to the TEF gene region were selected, for which DNAs from 33 strains monosporic were selected. The primer pairs EF1 and EF2 (O’Donnell et al., 1998; Geiser et al., 2004) (Table 1) were used with an alignment temperature of 55 °C.

Enzymatic sequencing

Only the amplified products of the TEF gene region were excised from the agarose and purified through silica columns (EZ-10 Spin Column DNA Gel Extraction Kit BS354, Bio Basic Inc.). Once the purified PCR fragment was obtained, these samples were sent for sequencing to the National Laboratory of Genomics for Biodiversity (LANGEBIO) of the Center for Research and Advanced Studies (CINVESTAV-IPN), Unit Irapuato, Guanajuato, Mexico, based on the ddNTPs method (Sanger et al., 1977), using a 3730 XL DNA sequencer (Applied Biosystems, Foster City, CA) and the Big DyeTerminator 3.1 kit (Applied Biosystems, Foster City, CA). The search for similarity between DNA sequences was made through the BLAST program, with which the nucleotide sequences under study were compared with the databases of the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/BLAST/), identifying the homology values.

Postulate of Koch de Fusarium cf. bullatum

The seeds of the Aperlado creole corn were obtained from the maize germplasm bank of the Valle de Culiacan Experimental Field-INIFAP. For the preparation of the inoculum of the fungus (accession number in GenBank-NCBI, KR612339), it was grown in PDA culture medium supplemented with PCNB (1.5 mL L-1) and cefuroxime (200 mg L-1) for one week, 25 ºC. From this medium, eight fragments of mycelium were cut and deposited in a flask with AMA medium (sand 450 g, corn flour 50 g, sterile water 50 mL) incubated under the same conditions for 15 days. Disinfestation of maize seeds was washed in a 3% sodium hypochlorite solution for 3 min and then rinsed in sterile distilled water and for germination they were deposited in an incubator at 25 °C for 48 h.

Germinated seeds, these were selected for uniformity in size, depositing one seedling per pot. For the preparation of the soil-substrate, a mixture of dead soil (1.5 kg), peat (0.5 kg) and half AMA (0.250 kg) (with inoculum of the fungus) was made and 600 g of this mixture were deposited in pots previously sterilized. The inoculum quantity for this species was 5 000 ufc g-1 of soil. The experiment was carried out based on the protocol of Trapero and Jimenez (1985) and Navas et al. (2007) in a greenhouse under controlled conditions at a temperature of 25 ±3 °C and a photoperiod of 12 h, for 60 days. Two repetitions of pots were performed, including the controls without inoculum.

Phylogenetic analysis

The alignment of the nucleotide sequences of the elongation factor EF-1α of Fusarium species was performed with the Clustal W method and the dendrogram was constructed with the Máxima Parsimonia method using the SPR algorithm (Nei and Kumar, 2000) and a bootstrap of 1 000 replicas (Felsenstein, 1985). All analyzes were performed with the MEGA program version 6.0 (Tamura et al., 2013).

Results and discussion

Molecular identification of Fusarium spp by PCR

We obtained 116 monosporic cultures, 25 seedling isolates, 36 adult plant and 55 ear, all with rot damage to which the genus Fusarium was identified by the morphology of bicellular microconidia, septate and canoe macroconidia. and the septate mycelium, according to the keys proposed by Leslie and Summerell (2006) (Figure 2).

Figure 2. Fusarium morphology: a) microconidia (m), macroconidia (M); b) mycelium.

To each monosporic isolate the DNA was extracted for specific amplification by PCR with the use of primers described for the species: F. oxysporum, F. verticilloides, F. subglutinansy F. proliferatum (Table 1). Of the 116 samples that were morphologically identified as Fusarium spp., 35 (30.17%) amplified the predicted fragment of 350 bp, for F. oxysporum (Figure 3), a species that has been mentioned causing vascular damage in this crop in the state of Puebla, Mexico (García and Martínez, 2010).

Figure 3. Electrophoretic analysis in 1% agarose. Amplification of the 350 bp fragment by PCR with FOF and FOR specific primers to detect F. oxysporum. Lanes: 1= Gene Ruler 1Kb DNA Ladder; 2-12= Fusarium DNA obtained from sick corn collected in different localities of the state of Sinaloa; 13= positive control (DNA of F. oxysporum) and 14= negative control (without DNA).

Of the DNA extracted from the total monosporic decepas, 70 samples amplified with the primers described for F. verticilloides (60.34%), this species presenting the highest frequency of amplifications in this study, confirming its prevalence worldwide (Gimeno and Martins, 2011). Recent studies indicate that F. verticilloides is the main species causing damage to root and stem rot in corn in the state of Sinaloa (Lopez et al., 2014). In Figure 4, the amplified fragments with a predicted size of 578 bp described for the species F. verticilloides are observed (Table 1).

Figure 4. Electrophoretic analysis in 1% agarose. Amplification of the 578 bp fragment by PCR with specific VER1 and VER2 primers to detect F. verticilloides. 1= Gene Ruler 1Kb DNA Ladder, 2-13= Fusarium DNA obtained from sick corn collected in localities of the state of Sinaloa, 14= positive control (F. verticilloides DNA) and 15= negative control (without DNA).

Only three of the 116 samples analyzed amplified with the primers corresponding to F. subglutinans (2.59%). In Figure 5, the amplified fragments with a predicted size of 631 bp are observed. Worldwide, this species after F. verticilloides is the second causal agent of corn root rot (Gimeno and Martins, 2011). In Mexico, F. subglutinans has been found in the state of Guanajuato (Figueroa et al., 2010) and in the State of Mexico (Morales et al., 2007; Rivas et al., 2011).

Figure 5. Electrophoretic analysis in 1% agarose. Amplification of the 631 pb fragment by PCR with specific SUB1 and SUB2 primers to detect F. subglutinans. 1= Gene Ruler 1Kb DNA Ladder; 2-6= Fusarium DNA obtained from samples of sick corn collected in localities of the state of Sinaloa, 6= positive control (DNA of F. subglutinans) and 7= negative control (without DNA).

Regarding the detection with the specific primers of F. proliferatum, no amplifications were observed in the eight DNA samples analyzed, which were amplified with the TEF primers and included among the 33 sequenced samples.

Enzymatic sequencing

Of the 116 amplifications that were obtained in total, 32 fragments were sequenced. The identity of the sequences in our study showed a high similarity for seven different species. Table 2 shows the accession numbers in the NCBI, tissue where they were isolated, location and the percentage of homology. For this, each of our accessions was compared with the database of the National Center for Biotechnology Information (NCBI-USA), which generated the homology values with each accession described for the different species, from which the identity of: F. verticilloides, F. oxysporum, F. subglutinans, F. nygamai Burgess &Trimboli (teleomorph: Gibberella nygamai Klaasen & Nelson), F. andiyazi Marasas, Rheeder, Lamprecht, Zeller & Leslie (without sexual reproduction), F. cf. bullatum and F. equiseti (Corda) Saccardo (teleomorph: Gibberella intricans Wollenweber) whose accession numbers are described in Table 2.

Table 2. Identity of Fusarium species based on the sequencing of the TEF (EF-1α) gene.

Strain

Location

Tissue

Accession to GenBank

Association based on the sequence

Identity (%)

Comparative accession of GenBank

526MC

Ahome

Cob

JN806238

F. verticilloides

100%

JF740729

527MC

Ahome

Cob

JN806239

F. verticilloides

100%

JF740729

528MC

Ahome

Cob

JN806240

F. verticilloides

100%

JF740729

529MC

Ahome

Cob

JN806241

F. verticilloides

100%

JF740729

530MC

Ahome

Cob

JN806242

F. verticilloides

100%

JF740729

532MC

Ahome

Cob

JN806243

F. verticilloides

100%

JF740729

533MC

Ahome

Cob

JN806244

F. verticilloides

100%

JF740729

536MC

Ahome

Cob

JN806245

F. verticilloides

100%

JF740729

538MC

Ahome

Cob

JN806246

F. verticilloides

100%

JF740729

610CS

Culiacán

Seedling

KR905566

F. verticilloides

100%

JF740729

613CUL

Culiacán

Seedling

KF753752

F. cf. bullatum

99%

JX268977

622CS

Culiacán

Seedling

KR905551

F. verticilloides

100%

JF740729

623MS

Ahome

Seedling

KR905567

F. cf. bullatum

100%

JX268977

627CS

Culiacán

Seedling

KR905552

F. verticilloides

100%

JF740729

630CS

Culiacán

Seedling

KR905553

F. verticilloides

100%

JF740729

635CS

Culiacán

Seedling

KR905554

F. verticilloides

100%

JF740729

638ES

Elota

Seedling

KR905555

F. verticilloides

100%

JF740729

646ES

Elota

Seedling

KR905556

F. verticilloides

100%

JF740729

649ES

Elota

Seedling

KR905557

F. verticilloides

100%

JF740729

652MS

Ahome

Seedling

KR905558

F. nygamai

100%

JF740790

655ES

Elota

Adult plant

KR905559

F. verticilloides

100%

JF740729

663ES

Elota

Adult plant

KR905560

F. verticilloides

100%

JF740729

676ES

Elota

Adult plant

KR905562

F. verticilloides

100%

JF740729

677CS

Culiacán

Adult plant

KR905563

F. verticilloides

100%

JF740729

678CS

Culiacán

Adult plant

KR612341

F. nygamai

100%

JF740790

680MS

Ahome

Adult plant

KR706385

F. equiseti

91%

KF514661

681CS

Culiacán

Seedling

KR706384

F. equiseti

91%

KF514661

706ES

Elota

Seedling

KR612339

F. cf. bullatum

100%

JX268977

771CS

Culiacán

Adult plant

KR706383

F. subglutinans

99%

DQ837698

777ES  

Elota

Adult plant

KR612338

F. andiyazi

99%

KM462947

789ES

Elota

Adult plant

KR905564

F. oxysporum

99%

KM092371

843CS

Culiacán

Adult plant

KR612340

F. oxysporum

100%

DQ435354

The species F. equiseti has been identified in the Bajio area, Guanajuato, Mexico (Figueroa et al., 2010); however, Leslie and Summerell (2006) state that the species is considered a saprophyte or secondary invader; however, Madania et al. (2013) has reported it in Syria causing damage to corn plants. As for F. nygamai, it has been identified in Sinaloa worldwide causing damage (Leyva et al., 2014), which was identified in this study.

With regard to F. andiyazi, it has been described with cob rot damage in China (Zhang et al., 2014), Syria (Madania et al., 2013) and also in Sinaloa, Mexico (Leyva et al., 2014). Finally, for F. cf. bullatum there is a report in Iran that reports its isolation and damage in maize (Rahjoo et al., 2008).

Postulate of Koch de Fusarium cf. bullatum

After 60 days of inoculation under controlled conditions, it was observed that creole corn was damaged and root rot was damaged by Fusarium cf. bullatum (Fig. 6), then monosporic strains were isolated and morphologically observed macroconidia (4-5-septa) (Figure 7 a, m), microconidia (1-2 septa) (Figure 7 a, m) and phialides on carnation leaf agar (CLA) (Figure 7-b). Later, a strain was asylated by DNA and through the TEF gene it was identified molecularly that it is Fusarium cf. bullatum. Enzymatic sequencing was recorded in the NCBI gene bank (GenBank-NCBI-USA) with accession number KX545253.

Figure 6. Koch postulate of Fusarium cf. bullatum showing damage to the maize Aperlado creole under controlled conditions in the greenhouse.

Figure 7. Fusarium cf. bullatum morphology: a) microconias (m); macroconidia (M); and b) phialides.

Phylogenetic analysis

The phylogenetic relationship of Maximum Parsimony of the elongation factor EF-1α of Fusarium species was analyzed in 32 sequences with 587 positions using the model of nucleotide replacement SPR (pruning and reconnection of a subtree), which better adjusted to EF-1α. The analysis of the sequences generated 8 trees of maximum parsimony, with consistency indexes of 83.5% and retention of 92%, both indices of wide reliability in phylogenetic comparisons (Nei and Kumar 2000). The consensus of these trees retains a total of 9 clades.

According to the Fusarium mating population (Summerell and Leslie, 2006), F. verticillioides and F. andiyazi, synonyms of Gibberella fujikuroi belong to mating population A, coincidentally, they were part of the same group in our dendogram (Figure 6). In the 99% cluster in which F. oxysporum, F. nygamai and F. subglutinans are found, which have previously been described within the mating population G (Summerell and Leslie, 2006); in this analysis, this grouping among these species was also reflected in the dendrogram (Figure 6).

Figure 8. Maximum Parsimony Dendrogram based on sequences of the EF-1α elongation factor of Fusarium species. The dendrogram was constructed with 32 nucleotide sequences, analyzing 587 positions and a Felsenstein index of 1 000 replicas.

The cluster where F. equiseti and F. cf. bullatum, is separated from the mating population A and G, which was recently described as a new complex (Castella and Cabañes, 2014); however, Summerell and Leslie (2006) mention as F. equiseti var bullatum within the same species.

Conclusions

The distinction of species within the Fusarium genus using morphological characters was not precise.

The use of specific primers used for the identification of Fusaria species in order to know, first hand, the incidence of each species detected, gave results coinciding with the sequencing of the species: F. verticilloides, F. subglutinans and F. oxysporum.

With the use of the TEF primers, it was possible to confirm the identity and presence of seven species of Fusaria isolated in the maize: F. verticilloides, F. subglutinans, F. oxysporum, F. equiseti, F. nygamai, F. andiyazi and F. cf. bullatum.

F. verticilloides was the predominant species with 60.34%, F. oxysporum was the species that occupied the second place, with an incidence of 30.17%, F. subglutinans and F. cf. bullatum in third place with an incidence of 2.59%.

According to our results, the close phylogenetic relationship between the species F. verticillioides and F. andiyazi coincided with the mating population A described by Summerell and Leslie (2006), as well as F. oxysporum, F. nygamai and F. subglutinans, within of mating population G and for the case of F. equiseti and F. cf. bullatum that formed a separate group, were associated with a new complex described by Castella and Cabañes, (2014).

This research reports for the first time the presence in Mexico of Fusarium cf. bullatum causing damage to corn.

Cited literature

Anderson, E. 1946. Maize in Mexico. A preliminary survey. Annals of Missouri Botanical Garden. 33(2):147-247.

Bacon, C. W.; Hinton, D. M. and Richardson, M. D. 1994. A corn seedling assay for resistance to Fusarium moniliforme. Plant Dis. 78(3):302-305.

Bertechini, F. C.; Lumi, A. C. A.; da Silva, C. N.; Tessmannand, D. J. and Barbosa, T. I. P. 2012. New PCR Assays for the Identification of Fusarium verticillioides, Fusarium subglutinans, and other species of the Gibberella fujikuroi Complex. Int. J. Mol. Sci. 13:115-132.

Briones-Reyes, D.; Castillo-González, F.; Chávez-Servia, J. L.; Aguilar- Rincón V. H.; García-de Alba, C. L. y Ramírez-Hernández, A.  2015. Respuesta del maíz nativo del altiplano mexicano a pudrición de mazorca, bajo infección natural. Agron. Mesoam. 26(1):73-85.

Campos-Macías, P.; Arenas-Guzmán, R. and Hernández-Hernández, F. 2013. Fusarium subglutinans: a new eumycetoma agents. Medical Mycology Case Reports. 2:128-131.

Castellá, G. and Cabañes, F. J. 2014. Phylogenetic diversity of Fusarium incarnatum equiseti species complex isolated from Spanish wheat. Antonie Van Leeuwenhoek.
106(2):309-317.

Ceecam. 2012. Centro de estudios para el cambio en el campo mexicano. La determinación de los centros de origen y diversidad genética del maíz. Análisis crítico de la propuesta oficial. http://mapserverceccam.org/tfc/Documentos/CODGM.pdf.

De Souza, M.; Matsuzawa, T.; Lyra, L.; Busso-Lopes. A. F.; Gonoi, T.; Zaninele-Schreiber A.; Kamei, K.; Moretti, M. L. and Trabasso, P. 2014. Fusarium napiforme systemic infection: case report with molecular characterization and antifungal susceptibility tests. Springer Plus. 30(3):492.

Eckard, S.; Wettstein, F. E.; Forrer, H. R. and Vogelgsang, S. 2011.Incidence of Fusarium species and mycotoxins in silage maize. Toxins. 3:949-967.

Espinosa, A.; Tadeo, M.; Turrent, N.; Gómez, N.; Sierra, M.; Caballero, F.; Palafox, A. y Rodríguez, A. 2008. El potencial de las variedades nativas y mejoradas de maíz. Ciencias. 92-93:118-125.

Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 39(4):783-791.

Figueroa-Rivera, M. G.; Rodríguez-Guerra, R.; Guerrero-Aguilar, B. Z.; González-Chavira, M. M.; Pons-Hernández, J. L.; Jiménez-Bremont, J. F.; Ramírez-Pimentel, J. G.; Andrio-Enríquez, E. y Mendoza-Elos, M. 2010. Caracterización de especies de Fusarium asociadas a la pudrición de raíz de maíz en Guanajuato, México. Rev. Mex. Fitopatol. 28(2):124-134.

García-Aguirre, G. y Martínez-Flores, R. 2010. Especies de Fusarium en granos de maíz recién cosechado y desgranado en el campo en la región de Ciudad Serdán, Puebla. Rev. Mex. Biod. 81(1):15-20. 

Geiser, D. M.; Jiménez, G. M. M.; Kang, S.; Makalowska, I.; Veeraraghavan, N.; Ward, T. J.; Zhang, N.; Kuldau G. A. and O’Donnell, K. 2004. Fusarium-ID v.1.0: a DNA sequence database or identifying Fusarium. Eur. J.  Plant Pathol. 110:473-479.

Gimeno, A. y Martins, M. L. 2011. Micotoxinas y micotoxicosis en animales y humanos. 3a (Ed.). Special nutients Inc. Miami, FL, USA. 128 p.

Goodman, M. M. and Bird, R. McK.  1977. The races of maize IV: tentative grouping of 219 Latin American races. Econ. Bot. 31(2):204-221.

Hernández-Juárez, A.; Aguirre-Uribe, L. A.; Flores-Dávila, M.; Cerna-Chávez, E; Landeros-Flores, J.; Ochoa-Fuentes, Y. M. y Frías-Treviño, G. A. 2016. Incidencia y severidad de pudrición de mazorcas de maíz genéticamente modificado y convencional en Sinaloa, México. Rev. Mex. Cienc. Agríc. 7(6):1477-1484.

Hernández, X. E. y Flores G. A. 1970. Estudio morfológico de cinco nuevas razas de maíz de la Sierra Madre Occidental de México: implicaciones filogenéticas y fitogeográficas. Agrociencia. 5(1):3-30.

Hsuan, H. M.; Zakariaand, L. and Salleh, B. 2010. Characterization of Fusarium isolates from rice, sugarcane and maize using RFLP-IGS. J. Plant Protect. Res. 50(4):409-415.

Kaur, H.; Mohan, C.; Vikal, Y. and Singh, M. 2014. Pathogenic and molecular characterization of Fusarium moniliforme Sheld, the incitant of Fusarium maize stalk rot in the Punjab State of India.  Maydica. 59(3):290-297.

Leslie, J. F. and Summerell, B. A. 2006. The fusarium laboratory manual. Ames, Iowa, USA. Blackwell Publishing. 388 p.

Leyva-Madrigal, K. Y.; Larralde-Corona, C. P.; Apodaca-Sánchez, M. A.; Quiroz-Figueroa, F. R.; Mexia-Bolaños, P. A.; Portillo-Valenzuela S.; Ordaz-Ochoa J.; Maldonado-Mendoza I. E. 2015. Fusarium species from the Fusarium fujikuroi species complex involved in mixed infections of maize in Northern Sinaloa, Mexico. J. Phytopathol. 163(6):1-15.

Leyva-Madrigal, K. Y.; Larralde-Corona, C. P; Calderón-Vázquez, C. L. and Maldonado-Mendoza, I. E. 2014. Genome distribution and validation of novel microsatellite markers of Fusarium verticillioides and their transferability to other Fusarium species. J. Microbiol. Methods. 101:18-23.

Lin, Z.; Xu, S.; Que, Y.; Wang, J.; Comstock, J. C.; Wei, J.; McCord, P. H.; Chen, B.; Chen, R. and Zhang, M. 2014. Species specific detection and identification of Fusarium species complex, the causal agent of sugarcane Pokkah Boeng in China. PLoS ONE. 9(8):1-14.

López-Valenzuela, B. E.; Armenta, B. A. D.; Apodaca, S. M. A.; Ruelas, J. R.; Palacios-Mondaca, C. A. y Valenzuela E. F. 2014. Reducción de la fertilización sintética con composta y optimización del riego sobre la pudrición del tallo (Fusarium spp.) del maíz. Sci. Agrop. 5(3):121-133.

Madania, A. M.; Altawil, W.; Naffaa, V. H. P. and Hawat, M. 2013. Morphological and molecular characterization of Fusarium isolated from maize in Siria. J.  Phytopathol. 161(7):452-458.

Mesterházy, A.; Lemmens, M. and Reid, L. M. 2012. Breeding for resistance to ear rots caused by Fusarium spp. in maize-a review. Plant Breed. 131(1):1-19.

Mishra, P. K.; Fox, R. T. V. and Culham, A. 2003. Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusaria. FEMS Microbiology Letters. 218(2):329-332.

Morales-Rodríguez I.; Yañez-Morales, M. J; Silva-Rojas, H. V.; García-de Los Santos, G., and Guzmán-de Peña, D. A. 2007. Biodiversity of Fusarium species in Mexico with ear rot in maize, and their identification using a phylogenetic approach. Mycopathologia. 163(1):31-39.

Mulé, G.; Susca, A.; Stea, G. and Moretti, A. 2004. A species-specific PCR assay based on the calmodulin partial gene for identification of F. verticillioides, F. proliferatum and F. subglutinans. Eur. J. Plant Pathol. 110(5-6):495-502.

Navas-Cortés, J. A.; Landa, B. B.; Méndez-Rodríguez, M. A. and Jiménez-Díaz, R. M. 2007. Quantitative modeling of the effects of temperature and inoculum density of Fusarium oxysporum f. sp. ciceris races 0 and 5 on development of Fusarium wilt in chickpea cultivars. Phytopathology. 97:564-573.

Nei, M. and Kumar, S. 2000. Molecular evolution and phylogenetics. Oxford University Press, New York, USA. 352 p.

O’Donnell, K.; Kistler, H. C.; Cigelink, E. and Ploetz, R. C. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Nat. Acad. Sci. USA. 95(5):2044-2049.

Rahjoo, V.; Zad, J.; Javan, N. M.; Mirzadi, G. A.; Okhovvat, S. M. and Bihamta, M. R. 2008 Morphological and molecular identification of Fusarium isolated from maize ears. Iran J. Plant Pathol. 90(3):463-46.

Rivas, V. P.; Virgen, V. J.; Rojas, M. I.; Cano, S. V. y Ayala, E. V. 2011. Evaluación de la pudrición de mazorca de híbridos de maíz en Valles Altos. Rev. Mex. de Cien. Agríc. 2(6):845-854.

Sánchez, J. J.; Goodman, M. M. and Stuber, C. W. 2000. Isozymatic and morphological diversity in the Races of maize of México. Econ. Bot. 54(1):43-59.

Sanger, F.; Nicklen, S. and Coulson, R. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Nat. Acad. Sci. USA. 74(12):5463-5467.

Tamura, K.; Stecher, G.; Peterson, D.; Filipski A. and Kumar, S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30(12):2725-2729.

Tezcan, G.; Ozhak-Baysan, B.; Alastruey-Izquierdo, A.; Ogunc, D.; Ongut, G.; Yildiran S. T.; Hazar, V.; Cuenca-Estrella. M. and Rodríguez-Tudela, J. L. 2009. Disseminated fusariosis caused by Fusarium verticillioides in an acute lymphoblastic leukemia patient after allogeneic hematopoietic stem cell transplantation. J. Clin. Microbiol. 47(1):278-281.

Trapero-Casas, A. and Jiménez-Díaz, R. M. 1985. Fungal wilt and root rot diseases of chickpea in southern Spain. Phytopathology. 75:1146-1151.

Velarde-Félix, S.; Ortega-Murrieta, P. F.; Fierros-Leyva, G. A.; Padilla-Valenzuela, I.; Gutiérrez-Pérez, E.; Rodríguez-Cota, F. G.; López-Valenzuela, J. A.; Acosta-Gallegos, J. A. y Garzón-Tiznado, J. A. 2015. Identificación molecular y biológica de las razas 0 y 5 de Fusarium oxysporum Schlechtend.: Fr f. sp. ciceris (Padwick) Matuo & K. Sato del garbanzo en el Noroeste de México. Rev. Mex. Cien. Agríc. 6(4):735-748.

Zhang, H.; Luo, W.; Pan, Y.; Xu, J.; Xu, J. S.; Chen, W. Q. and Feng, J. 2014. First report of Fusarium ear rot of maize caused by Fusarium andiyazi in China. Plant Dis. 98(10):1428.