Revista Mexicana de Ciencias Agrícolas volume 13 number 6 August 14 - September 27, 2022
DOI: https://doi.org/10.29312/remexca.v13i6.3030
Article
Identification of endophytic fungi of Ageratina pichinchensis with antagonistic activity against phytopathogens of agricultural importance
Valeria Camacho-Luna1
Aida Aracelí Rodríguez-Hernández2
Mario Rodríguez-Monroy1
Robledo Norma3
Gabriela Sepúlveda-Jiménez1§
1Department of Biotechnology-Center for the Development of Biotic Products-National Polytechnic Institute. CEPROBI street num. 8, Colonia San Isidro, Yautepec, Morelos, Mexico. ZC. 62731. (vcamachol1100@alumno.ipn.mx; mrmonroy@ipn.mx).
2CONACYT-National Polytechnic Institute- Center for the Development of Biotic Products. CEPROBI street num. 8, Colonia San Isidro, Yautepec, Morelos, Mexico. ZC. 62731. (arodriguezhe@ipn.mx).
3CONACYT-National Polytechnic Institute-Center for the Development of Biotic Products. CEPROBI street num. 8, Colonia San Isidro, Yautepec, Morelos, Mexico. ZC. 62731. (nrobledo@ipn.mx).
§Corresponding author: gsepulvedaj@ipn.mx.
Abstract
Ageratina pichinchensis is a medicinal plant, endemic to Mexico, known as Axihuitl. The extracts of the leaves show antifungal activity against dermatophytic fungi, but there are no studies of the identification of endophytic fungi. The objective was to identify endophytic fungi of A. pichinchensis with potential as biological control agents of phytopathogens. Fifty-five morphospecies of endophytic fungi that belong to the phylum Ascomycota were isolated from the leaves of A. pichinchensis. Molecular identification based on the analysis of the sequences of internal transcribed spacers (ITSs) amplified by PCR showed that six of the most frequent fungi correspond to Remotididymella anthropophila and Diaporthe caatingaensis and to the genera Diaporthe, Phomopsis and Fusarium. In multiple antagonism assays, seven morphospecies showed strong antagonistic activity against the pathogens Fusarium oxysporum, F. proliferatum and Stemphylium vesicarium. Two endophytic fungi belong to Alternaria alternata, another to Trichoderma longibrachiatum and two others are from the genera Alternaria and Phomopsis. While Nigrospora oryzae was the only most frequent endophyte and with antagonistic activity against the three pathogens. In dual culture assays, endophytes with strong antagonistic activity inhibited the mycelial growth of F. oxysporum and F. proliferatum by 37 to 80%, but in the poisoned food assay, T. longibrachiatum inhibited the mycelial growth of the two pathogens by 79% and 66%, respectively. For the first time, R. anthropophila as an endophytic fungus, as well as the identification and antagonistic activity of endophytic fungi of A. pichinchensis, are reported.
Keywords: Fusarium, Nigrospora, Remotididymella, Trichoderma, biocontrol.
Reception date: April 2022
Acceptance date: June 2022
Introduction
Endophytic microorganisms are those that colonize plant tissues, but without causing visible symptoms of the disease (Hardoim et al., 2015). In medicinal plant extracts, antimicrobial activity is related to the proportion of endophytes (Egamberdieva et al., 2017). Therefore, endophytic fungi of medicinal plants could be used as biocontrol agents of phytopathogens.
The medicinal plant Ageratina pichinchensis (Kunth) R.M. King & H. Rob (formerly called Eupatorium aschembornianum S. Schauer) is endemic to Mexico and is a wild perennial herb that grows in forested areas in 28 of the 32 Mexican states (Rzedowski and Rzedowski, 2001). In the state of Morelos, it is known as Axihuitl and grows in the protected natural area of the Chichinautzin Biological Corridor. It is a plant that is used in traditional medicine to treat gastric ulcers, skin infections, wounds and tumors (Avilés and Suárez, 1994). Leaf extracts have antifungal activity against the dermatophytic fungi Candida albicans and Aspergillus niger (Ríos et al., 2003). However, studies of the identification of endophytic fungi of A. pichinchensis with antagonistic activity against phytopathogens are scarce.
Fungi of the genera Fusarium and Stemphylium cause disease in various crops. Fusarium oxysporum causes vascular wilt or root rot in crops such as alfalfa, beans, cotton, lettuce, onion, peas, pepper, potato, soybeans, spinach, and tomato (Munkvold, 2017). F. proliferatum is a component of the ear and stem rot complex in corn, asparagus, bananas, date palms, figs, mangoes, pines, sorghum and onions (Munkvold, 2003). Stemphylium vesicarium is the causative agent of the leaf blight disease in onion and garlic (Rao and Pavgi, 1975; Zapata-Sarmiento et al., 2020) and also affects asparagus, broad beans and rice (Sheikh et al., 2015; Graf et al., 2016; Foster et al., 2019). Therefore, the objective of this study was the identification of endophytic fungi of A. pichinchensis with potential for the biological control of phytopathogens of the genera Fusarium and Stemphylium.
Materials and methods
Collection of plant material
Ageratina pichinchensis plants were collected in October 2019 in the Chichinautzin Biological Corridor, Morelos, Mexico, geographical coordinates 18° 59’ 26.4” north latitude 99° 17’ 09.2” west longitude. A specimen was deposited in the HUMO Herbarium of the Autonomous University of the State of Morelos (Voucher 3571), and the plants were identified by trained personnel from the same institution. The plants were about 1 m tall and were in the flowering stage. In total, 40 leaves without symptoms of disease were collected from 20 plants, two leaves per each plant.
Isolation of endophytic fungi and their classification into morphospecies
Endophytic fungi were isolated and classified into morphospecies according to Arnold et al. (2001). Five fragments of 5 mm2 were cut from the leaves and the surface of the fragments was disinfected with ethanol (70%) for 2 min, with sodium hypochlorite (0.52%) for 2 min and two washes with sterile distilled water.
To evaluate the efficacy of disinfection, an impression from each fragment was obtained in potato, dextrose and agar culture medium (PDA, Bioxon) in Petri dishes, which were incubated for eight days. The absence of mycelial growth indicated that the disinfection method was effective in eliminating epiphytic fungi. At the same time, the five fragments were dried and placed in Petri dishes with PDA culture medium. The Petri dishes were incubated at 27 ±2 °C with a photoperiod of 12 h light: 12 h darkness until observing the growth of the hyphae. The tips of the hyphae were subcultured to obtain pure colonies in Petri dishes with PDA.
Fungi were classified into morphospecies according to the following morphological characteristics: spore production, aerial mycelium, colony color, culture medium color, surface texture, and edge characteristics. The relative frequency (RF) of each morphospecies was calculated according to Photita et al. (2001) and the following formula:

Multiple antagonism assay
Previously, isolates of F. oxysporum, F. proliferatum were obtained from onion bulbs and the isolate of S. vesicarium was obtained from onion leaves. Prior to carrying out the assays, pathogenic fungi such as endophytes were cultured in the PDA medium (Bioxon), at 27 ±2 °C with a photoperiod of 12 h light:12 h darkness for seven days.
The antagonistic activity of each morphospecies against the three phytopathogens was evaluated in a multiple antagonism assay described by Sánchez-Fernández et al. (2015). Three repetitions were made for each endophyte in multiple confrontation and the controls. The results were analyzed in triplicate by means of cluster analysis with the ‘fastcluster’ package of Rstudio version 3.4.2. Antagonistic activity was classified according to the modified scale of Yuen et al. (1999) as: a) strong, the endophytic fungus inhibits the growth of pathogens and grows to and surrounds the pathogen; b) weak, the endophytic fungus and the pathogen grow and their hyphae intermix and do not reduce their growth; c) mutual, the endophytic fungus and the pathogen grow to contact and stop growing; and d) null, the pathogen grows to the endophyte, surrounds it and inhibits its growth.
Molecular identification of endophytic fungi with the highest antagonistic activity
Endophytic fungi that were found with a RF greater than 5% and that in the multiple antagonism assay showed strong antagonistic activity were cultured in PDA medium (Difco) for 7 days. The mycelium was collected, frozen and pulverized in a mortar with liquid N2. For DNA purification, the Dneasy Plant Mini Kit (Quiagen, Germany) was used. The ITS regions of the fungi were amplified using the primers ITS 1 (5’ TCCGTAGGTGAACCTGCGG 3’) and ITS4 (5’ CTGTTGGTTTCTTTTCCTCCGC 3’) designed by White et al. (1990). The amplification conditions were those reported by Zapata-Sarmiento et al. (2020).
The sequencing was performed by the company Macrogen Inc Services (Seoul, Korea). The consensus sequence was obtained with the BioEdit Program (version 7.0.5) and the sequences were deposited in GenBank with the Blast program of the National Center for Biotechnology Information database. Based on the results of the Blast analysis, an identity ≥ 98 to 100% and a coverage ≥ 80% with other sequences were considered to assign a name to a species. Sequences that did not meet these criteria were assigned the name at the genus level.
Dual culture assay
Endophytic fungi with strong antagonistic activity were selected to evaluate their antagonistic activity in dual culture assays against F. oxysporum and F. proliferatum according to Zapata-Sarmiento et al. (2020). Six repetitions were made for each endophytic fungus in dual culture with each pathogen and the controls. Every 24 h photographs of the cultures were taken, and the images were analyzed using the ImageJ program (version 1.8) to calculate the area (cm2) of mycelial growth of the pathogen.
The percentage of mycelial growth inhibition (MGI) was calculated using the equation: MGI= (C-T) × 100 ÷ C. Where: C corresponds to the area of mycelial growth of the pathogen in the control; and T to the area of mycelial growth in the dual culture.
The data were analyzed by means of an analysis of variance (Anova) and the comparison of means using the Tukey test in Rstudio (version 1.2.1335) with the Agricolae library. The type of interaction between the endophytic fungus and the phytopathogen was recorded after 15 days of incubation. According to Bertrand et al. (2013), interactions were classified into: remote inhibition, zone of lines, contact inhibition and overgrowth.
Assay of antagonistic activity of non-volatile metabolites
The antagonistic activity of the cell-free filtrates of the endophytic fungi Trichoderma longibrachiatum-EA54 and Nigrospora oryzae-EA51 against F. oxysporum and F. proliferatum was evaluated by means of the poisoned culture technique according to Schmitz (1930). T. longibrachiatum and N. oryzae were grown in Petri dishes with PDA medium (Difco TM) for 7 days. With the culture of T. longibrachiatum, a suspension of spores was prepared at a concentration of 1x107 spores ml-1. In Erlenmeyer flasks (250 ml) with 50 ml of potato dextrose broth (PDB, Difco TM), 1.5 ml of the spore suspension was added. Because N. oryzae in PDA culture medium lacks reproductive structures, the flasks were inoculated with five blocks of culture medium with mycelium of 0.5 cm in diameter. Three Erlenmeyer flasks were prepared from each fungus.
The liquid cultures were incubated in a stirrer at 150 rpm and at 27 ±2 °C with a photoperiod of 12 h light: 12 h darkness. After four days, the culture broth was collected and centrifuged at 4 500 rpm for 10 min; the supernatant was filtered through 0.45 μm and then 0.22 μm membranes (GVWP, Millipore) to obtain the cell-free filtrate that was used to prepare the culture medium according to Zapata-Sarmiento et al. (2020). Six Petri dishes were prepared for each pathogen with each cell-free filtrate and the respective controls. Every 24 hours photographs were taken, and the images were analyzed with the ImageJ program (version 1.8) to calculate the area (cm2) of mycelial growth of the pathogen. The percentage of mycelial growth inhibition (MGI) was calculated using the equation:
.
Results and discussion
Classification and frequency of morphospecies of endophytic fungi
From the leaves of A. pichinchensis, 100 isolates of endophytic fungi were obtained. Based on morphological characteristics, the isolates were classified into 55 morphospecies. The isolate EA38 was the most frequent morphospecies with a relative frequency (RF) of 20%; followed by the isolates EA37, EA39 and EA40 with an RF of 15% and then the isolates EA30, EA42 and EA51 with an RF of 10%. The remaining isolates had a RF of 5%. Morphospecies is a functional taxonomic term useful for classifying endophytic fungi, which are very diverse in plants that grow in tropical environments. This classification is also useful for identifying endophytes that lack reproductive structures when cultured in vitro (Fröhlich and Hyde, 1999; Arnold et al., 2001). For these reasons, it was decided to use this classification for endophytic fungi of A. pichinchensis.
Antagonistic activity of morphospecies of endophytic fungi in multiple antagonism bioassays
The cluster analysis grouped the 55 morphospecies of endophytic fungi according to their antagonistic activity against S. vesicarium, F. proliferatum and F. oxysporum. Seven morphospecies (EA26, EA51, EA28, EA10, EA53, EA55 and EA54) showed strong antagonistic activity against the three pathogens. While the mycelial growth of S. vesicarium was strongly inhibited by 12 endophytic fungi and weakly inhibited by six. Mutual inhibition of mycelial growth with the three pathogens was observed with the isolates EA2 and EA37, but the isolate EA48 was the only one that showed mutual inhibition with S. vesicarium (Figure 1).
Figure 1. Cluster analysis of the antagonistic activity (strong, mutual, weak or null) of the endophytic fungi of Ageratina pichinchensis against Fusarium oxysporum, Fusarium proliferatum and Stemphylium vesicarium.
Figure 2 shows the interactions observed between the seven morphospecies of endophytic fungi classified with strong antagonistic activity against the pathogens. The morphospecies of the isolates EA10, EA28 and EA54 grew on the mycelium of the pathogens. While EA26, EA51, EA53 grew around the pathogens and the morphospecies EA55 grew on S. vesicarium and only grew around the two species of Fusarium.
Figure 2. Interactions observed in the multiple antagonism assay of the seven morphospecies of the endophytic fungi of Ageratina pichinchensis classified with strong antagonistic activity against the pathogens: a) Fusarium oxysporum; b) Fusarium proliferatum; and c) Stemphylium vesicarium.
Of the 55 morphospecies of endophytic fungi that were isolated from A. pichinchensis, 12 of them showed antagonistic activity against one pathogen and seven against the three pathogens. Similarly, the isolation of morphospecies of endophytic fungi of medicinal plants with antagonistic activity against pathogenic fungi is reported. In Etlingera elatior (ginger), the isolation of six morphospecies of endophytic fungi with antagonistic activity against Fusarium oxysporum, Ganoderma boninense and Rigidoporus lignosus is reported (Lutfia et al., 2020) and in Aloe dhufarensisi, two morphospecies of endophytic fungi with antagonistic activity against Fusarium sp. and Cladosporium sp. were isolated (Al-Rashdi et al., 2020).
Based on the results of the multiple antagonism assay, the seven morphospecies of endophytic fungi with strong antagonistic activity were selected for their identification at the molecular level and to perform the assays of antagonistic activity in dual culture and poisoned food culture.
Identification of endophytic fungi with strong antagonistic activity against pathogens
Table 1 shows the identification at the molecular level of the 12 isolates of endophytic fungi that were found with a RF greater than 5% and that also showed a strong antagonistic activity. The sequences of the isolates EA30 and EA40 met the criteria of identity (≥ 98%) and coverage (> 80%) corresponding to sequences of Remotididymella anthropophila and Diaporthe caatingaensis, respectively. The sequence of the isolate EA37 also met the criterion of identity and coverage, but it is with a sequence from the gene bank of an unidentified species of the genus Phomopsis. For the isolates EA38 and EA39, the identity value was less than 98%, so they were placed in the genus Diaporthe.
Table 1. Molecular identification of endophytic fungi of Ageratina pichinchensis with a relative frequency (RF) greater than 5% and that showed a strong antagonistic activity against the pathogens Fusarium oxysporum, Fusarium proliferatum and Stemphylum vesicarium.
Morphospecies | Species | No. of access | Identity (%) | Coverage (%) | |
With RF greater than 5% | EA30 | Remotididymella anthropophila | MT150607 | 99.1 | 99 |
EA37 | Phomopsis sp. | MT150610 | 99 | 100 | |
EA38 | Diaporthe sp. | MT150611 | 97.8 | 91 | |
EA39 | Diaporthe sp. | MT150612 | 97.1 | 100 | |
EA40 | Diaporthe caatingaensis | MT150613 | 98.7 | 98 | |
EA42 | Fusarium sp. | MT362619 | 92.2 | 96 | |
With RF greater than 5%, antagonists | EA51 | Nigrospora oryzae | MT150620 | 99.8 | 97 |
Antagonists | EA10 | Alternaria alternata | MT107053 | 99.4 | 100 |
EA26 | Alternaria sp. | MT107054 | 99.8 | 100 | |
EA28 | Alternaria alternata | MT150606 | 99.5 | 100 | |
EA54 | Trichoderma longibrachiatum | MT150622 | 99 | 96 | |
EA55 | Phomopsis sp. | MT150623 | 99.5 | 99 | |
In the case of the isolate EA42, the identity was 92.2% and therefore, it was also only placed in the genus Fusarium. The isolate EA51 with an RF greater than 5% and with antagonistic activity against all pathogens showed an identity of 99.8% with Nigrospora oryzae sequences. The isolates of the fungi EA10 and EA28 with antagonistic activity showed an identity greater than 99% with sequences of Alternaria alternata species. The sequence of the isolate EA26 showed an identity of 99.8% with an unidentified species of the genus Alternaria and the sequences of the isolates EA54 and EA55 showed an identity of 99 and 99.5% with sequences of Trichoderma longibrachiatum and Phomopsis sp., respectively. Finally, the isolate EA53 was the only one that was not identified at the molecular level, but in the PDA medium it did not develop reproductive structures, it had aerial mycelium, the colony showed a dusty texture, with irregular edge, with rings and white.
Endophytic fungi belong to the orders Pleosporales, Trichophaeriales, Diapothales and Hypocreales. According to the molecular identification and relative frequency data, the genus Phomopsis (anamorph of Diaporthe) was the most frequent, followed by Fusarium sp., N. oryzae and R. anthropophila. Some of the species of endophytic fungi that were identified in A. pichinchensis are also reported in other species of plants of the genus Ageratina. The most abundant endophytic fungi in A. adenophora belong to the genus Phomopsis (Mei et al., 2014), while P. magnolia and N. oryzae are also reported as endophytes of A. altissima (Christian et al., 2016). Fungi of the genus Phomopsis are the endophytes that are most frequently isolated in tropical plant species (Murali et al., 2006).
The fungus N. oryzae is an endophyte with a cosmopolitan distribution and a wide range of hosts, Wang et al. (2017). The fungus R. anthropophila has not been reported as an endophyte in other plants; but this fungus belongs to the family Didymellaceae, which includes other species of fungi reported as endophytes and phytopathogens (Wang et al., 2017). Similar to our results, fungi of the genera Alternaria and Diaporthe are reported as endophytes of the medicinal plant Ocimum sanctum Linn., and also show antagonistic activity against F. oxysporum (Chowdhary and Kaushik, 2015). However, there are no reports of the antagonistic activity of Alternaria sp. and Phomopsis sp. against F. proliferatum and S. vesicarium. With respect to N. oryzae, it is reported to be an endophyte of Gossypium arboreum (cotton) with antagonistic activity against F. solani (Hiremani et al., 2020), but there are no reports of the antagonistic activity of Nigrospora against other species of Fusarium and S. vesicarium.
Antagonistic activity of endophytic fungi in dual culture assays
In dual culture, the seven isolates of selected endophytic fungi inhibited the mycelial growth of F. oxysporum and F. proliferatum from 37 to 80%. The isolates of T. longibrachiatum and N. oryzae showed the greatest antagonistic activity since they inhibited the growth of the two Fusarium species by more than 79% (Table 2).
Table 2. Antagonistic activity of endophytic fungi of Ageratina pichinchensis against Fusarium oxysporum and Fusarium proliferatum in dual culture assays.
Fusarium oxysporum | Fusarium proliferatum | ||||
MGI (%) | MG (cm2) | MGI (%) | MG (cm2) | ||
Control | 0 | 51 ±1.4 a | 0 | 58.8 ±3 a | |
T. longibrachiatum EA54 | 80 | 9.8 ±1.4 e | 80 | 11.2 ±1.8 e | |
Nigrosora oryzae EA51 | 79 | 10.6 ±1 e | 83 | 9.7 ±1.5 e | |
EA53 | 56 | 22.1 ±1.1 d | 53 | 27.7 ±1.2 d | |
Phomopsis sp. EA55 | 48 | 26.2 ±1.5 c | 49 | 30.1 ±0.4 cd | |
A. alternata EA10 | 46 | 27.3 ±2.5 c | 44 | 32.9 ±1.7 bc | |
A. alternata EA28 | 42 | 29.4 ±2.2 bc | 40 | 35.3 ±2.1 b | |
Alternaria sp. EA26 | 37 | 31.9 ±3 b | 42 | 34.3 ±1.2 bc | |
Each value corresponds to the mean ± standard deviation (n= 5). Values in the same column followed by different letters differ significantly according to Tukey’s HSD test (p< 0.05). MGI= mycelial growth inhibition; MG= mycelial growth.
In relation to T. longibrachiatum, it is reported to inhibit the growth of F. oxysporum from 27.2 to 68.7% (Sundaramoorthy and Balabaskar, 2013; Abdelrahman et al., 2016; Zhang et al., 2018). In this study, the isolate of T. longibrachiatum was found to inhibit the growth of F. oxysporum by up to 80%. In contrast, there are no reports of the antagonistic activity of T. longibrachiatum against F. proliferatum. But other Trichoderma species such as T. harzianum and T. gamsii inhibit the growth of F. proliferatum by 80% (Mondani et al., 2021), similar to what was reported in this study.
In the case of N. oryzae, studies of inhibition of the growth of fungi of the genus Fusarium are scarce. The percentage of growth inhibition of F. oxysporum and F. proliferatum found in this study is higher than that reported (43.06%) against F. solani (Hiremani et al., 2020). While N. oryzae is an endophyte of Tylophora indica that shows no antagonistic activity against F. oxysporum (Kumar et al., 2010). For F. proliferatum, there are no studies of the antagonistic activity of N. oryzae. Figure 3 shows the types of interaction between endophytic fungi and the pathogens Fusarium oxysporum and Fusarium proliferatum.
Figure 3. Types of interaction between endophytic fungi of Ageratina pichinchensis and the phytopathogens Fusarium oxysporum and Fusarium proliferatum in dual culture assays.
In the interaction of F. oxysporum and F. proliferatum with A. alternata EA10, Alternaria sp. EA26, Phomopsis sp. EA55 and EA53 (unidentified), the formation of a zone of lines was observed. The type of interaction between A. alternata EA28 and the two pathogens was different depending on the Fusarium species. With F. oxysporum, a zone of lines was observed, while with F. proliferatum, an overgrowth of the endophyte on the mycelium of the pathogen was observed. In contrast, N. oryzae grew on the mycelium of F. oxysporum but developed a zone of lines with F. proliferatum. Trichoderma longibrachiatum grew on both pathogens and also sporulated on them.
The presence of a zone of lines indicates that the mechanism of antagonistic activity is antibiosis (Bertrand et al., 2013), so it is suggested that A. alternata EA10, Alternaria sp. EA26, Phomopsis sp. EA55 and the isolate EA53 produce antibiotics against Fusarium.
In the ‘overgrowth’ interaction, it may involve, in addition to antibiosis, a competition for nutrients and space (Bertrand et al., 2013). Therefore, the results in dual culture and of the type of interaction indicate that the antagonistic activity of T. longibrachiatum with the two species of Fusarium is antibiosis and competition. However, the results on the type of interaction of the fungi N. oryzae and A. alternata EA28 against the two species of Fusarium indicate that the mechanisms of interaction depend on the species of the pathogen. Based on the results of the dual culture assay and the types of interaction, T. longibrachiatum and N. oryzae were selected to perform the poisoned food assays.
Antagonistic activity of non-volatile metabolites of Trichoderma sp. and N. oryzae against F. oxysporum and F. proliferatum
Cell-free filtrates of N. oryzae did not inhibit the growth of F. oxysporum and F. proliferatum. However, Trichoderma sp. inhibited the mycelial growth of both pathogens; F. proliferatum was inhibited by 66.5% and F. oxysporum by 79.5% (Table 3).
Table 3. Antifungal activity of filtrates of liquid cultures of Trichoderma sp. and Nigrospora oryzae against Fusarium oxysporum and Fusarium proliferatum.
Fusarium oxysporum | Fusarium proliferatum | ||||
MG (cm2) | MGI (%) | MG (cm2) | MGI (%) | ||
Control | 40.37 ±1.2 a | 0 | 28.78 ±1.1 a | 0 | |
Trichoderma sp. | 8.27 ±0.7 b | 79.5 | 9.63 ±0.6 b | 66.4 | |
N. oryzae | 39.37 ±1 a | 0 | 27.87 ±1.5 a | 0 | |
Each value corresponds to the mean ± standard deviation (n= 5). Values in the same column followed by different letters differ significantly according to Tukey’s HSD test (p< 0.05). MGI= mycelial growth inhibition; MG= mycelial growth.
The poisoned food technique confirmed that the antagonistic activity of N. oryzae was not due to the production of antibiotics and that N. oryzae inhibits the growth of the two Fusarium species by competition of space and nutrients. On the contrary, the results with T. longibrachiatum indicate that it is an endophytic fungus that inhibited the growth of the two species of Fusarium by the production of compounds with antibiotic activity.
Similarly, other authors report the antagonistic activity of Trichoderma against strains of F. oxysporum, but studies on the antagonistic activity of T. longibrachiatum against F. proliferatum are scarce. Based on our results, growth inhibition by compounds produced by T. longibrachiatum was greater against F. oxysporum than against F. proliferatum. Future studies could focus on characterizing the non-volatile metabolites produced by Trichoderma longibrachiatum and evaluating the effectiveness against the two pathogens.
Strains of T. longibrachiatum have been isolated from soil of the rhizosphere of a forest site (Zhang et al., 2018), from desert soil in Egypt (Abdelrahman et al., 2016) and from the rhizosphere of Solanum lycopersicum L. (tomato) (Sundaramoorthy and Balabaskar, 2013). But studies on the antagonistic activity of Trichoderma isolated from leaves and aerial parts of medicinal plants are scarce. Sarsaiya et al. (2020) reported that T. longibrachiatum isolated from stem segments of Dendrobium nobile produces dendrobine, a compound similar to that produced by the host plant and that shows antibacterial activity. Likewise, T. longibrachiatum isolated from the root of Suaeda glauca, a sea plant, produces sesquiterpenes and cyclodepsipeptides with antagonistic activity against soil pathogens (Du et al., 2020). These studies show the potential use of Trichoderma strains isolated from medicinal plants for agricultural purposes. Future studies will be aimed at identifying and characterizing metabolites produced by Trichoderma longibrachiatum isolated from A. pichinchensis leaves with antifungal activity against pathogens.
Conclusions
The most frequent endophytic fungi of A. pichinchensis belong to the phylum Ascomycota and include Remotididymella anthropophila and Diaporthe caatingaensis, and others that belong to the genera Diaporthe, Phomopsis and Fusarium. The endophytic fungi with antagonistic activity were Alternaria alternata and Trichoderma longibrachiatum and others that belong to the genera Alternaria and Phomopsis. The only frequent endophytic fungus that showed antagonistic activity is N. oryzae, which together with T. longibrachiatum stand out for their antagonistic activity against F. oxysporum and F. proliferatum. But they differ in their mechanism of antagonistic activity, in T. longibrachiatum it is due to the production of compounds with antibiotic activity, while the activity of N. oryzae is due to the competition for space and nutrients. This is the first report of R. anthropophila as an endophytic fungus and of the identification and antagonistic activity of endophytic fungi from A. pichinchensis leaves.
Acknowledgements
The research had the financial support of the Secretariat of Research and Postgraduate Studies of the National Polytechnic Institute (project 20220769). To Gabriel Flores Franco (HUMO Herbarium, Autonomous University of the State of Morelos) for the identification of the plants. VCL received a doctoral grant from CONACYT (Mexico) and from the Institutional Stimulus Scholarship for Researcher Training (BEIFI-IPN) program. GSJ and MRM are EDI and COFAA grantees.
Cited literature
Abdelrahman, M.; Abdel-Motaal, F.; El-Sayed, M.; Jogaiah, S.; Shigyo, M.; Ito, S. and Tran, L. P. 2016. Dissection of Trichoderma longibrachiatum-induced defense in onion (Allium cepa L.) against Fusarium oxysporum f. sp. cepa by target metabolite profiling. Plant Sci. 246:128-138. https://doi.org/10.1016/j.plantsci.2016.02.008.
Al-Rashdi, F. K. H.; Al-Sadi, A. M.; Al-Riyamy, B. Z.; Maharachchikumbura, S. S. N.; Al-Sabahi, J. N. and Velazhahan, R. 2020. Endophytic fungi from the medicinal plant Aloe dhufarensis Lavranos exhibit antagonistic potential against phytopathogenic fungi. S. Afr. J. Bot. 147:1078-1085. https://doi.org/10.1016/j.sajb.2020.05.022.
Arnold, A. E.; Maynard, Z. and Gilbert, G. S. 2001. Fungal endophytes in dicotyledonous neotropical trees: patterns of abundance and diversity. Mycol Res. 105(12):1502-1507. https://doi.org/10.1017/S0953756201004956.
Aviles, M. and Suárez, G. 1994. Catálogo de plantas medicinales. Jardín Etnobotánico, Centro INAH. Cuernavaca, Morelos, México. 47 p.
Bertrand, S.; Schumpp, O.; Bohni, N.; Bujard, A.; Azzollini, A.; Monod, M.; Gindro, K. and Wolfender, J. L. 2013. Detection of metabolite induction in fungal co-cultures on solid media by high-throughput differential ultra-high pressure liquid chromatography-time-of-flight mass spectrometry fingerprinting. J. Chromatogr. A. 1292:219-228. https://doi.org/ 10.1016/j.chroma.2013.01.098.
Chowdhary, K. and Kaushik, N. 2015. Fungal endophyte diversity and bioactivity in the Indian medicinal plant Ocimum sanctum Linn. PLoS One. 10(11):1-25. https://doi.org/10.1371/ journal.pone.0141444.
Christian, N.; Sullivan, C.; Visser, N. D. and Clay, K. 2016. Plant host and geographic location drive endophyte community composition in the face of perturbation. Microb Ecol. 72(3):621-632. https://doi.org/10.1007/s00248-016-0804-y.
Du, F. Y.; Ju, G. L.; Xiao, L.; Zhou, Y. M. and Wu, X. 2020. Sesquiterpenes and cyclodepsipeptides from marine-derived fungus Trichoderma longibrachiatum and their antagonistic activities against soil-borne pathogens. Mar Drugs. 18(3):4-13. https://doi.org/10.3390/ md18030165.
Egamberdieva, D.; Wirth, S.; Behrendt, U.; Ahmad, P. and Berg, G. 2017. Antimicrobial activity of medicinal plants correlates with the proportion of antagonistic endophytes. Front Microbiol. 8(148):1-11. https://doi.org/10.3389/fmicb.2017.00199.
Fröhlich, J. and Hyde, K. D. 1999. Biodiversity of palm fungi in the tropics: are global fungal diversity estimates realistic? Biodivers Conserv. 8(3):977-1004. https://doi.org/10.1023/ A:1008895913857.
Foster, J. M.; Tayviah, C. S.; Stricker, S. M.; Gossen, B. D. and McDonald, M. R. 2019. Susceptibility to Stemphylium vesicarium of asparagus, onion, pear, and rye in Canada. Can. J. Plant Pathol. 41(2):228-241. https://doi.org/10.1080/07060661.2019.1574901.
Graf, S.; Bohlen, J. H.; Miessner, S.; Wichura, A. and Stammler, G. 2016. Differentiation of Stemphylium vesicarium from Stemphylium botryosum as causal agent of the purple spot disease on asparagus in Germany. Eur. J. Plant Pathol. 144:411-418. https://doi.org/ 10.1007/s10658-015-0777-6.
Hardoim, P. R.; Van Overbeek, L. S.; Berg, G.; Pirttilä, A. M.; Company, S.; Campisano, A.; Döring, M. and Sessitsch, A. 2015. The hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiol. Mol. Biol. Rev. 79(3):293-320. https://doi.org/10.1128/MMBR.00050-14.
Hiremani, N. S.; Verma, P.; Gawande, S. P.; Sain, S. K.; Nagrale, D. T.; Salunkhe, V. N.; Shah, V.; Narkhedkar, N. G. and Waghmare, V. N. 2020. Antagonistic potential and phylogeny of culturable endophytic fungi isolated from desi cotton (Gossypium arboreum L.). S. Afr. J. Bot. 134:329-335. https://doi.org/10.1016/j.sajb.2020.03.008.
Kumar, S.; Kaushik, N.; Edrada, E. R.; Ebel, R. and Proksch, P. 2010. Isolation, characterization, and bioactivity of endophytic fungi of Tylophora indica. World J. Microbiol. Biotechnol. 27:571-577. https://doi.org/10.1007/s11274-010-0492-6.
Lutfia, A.; Munir, E. and Yurnaliza, Y. 2020. Molecular identification of endophytic fungi from torch ginger (Etlingera elator) antagonist to phytopathogenic fungi. Biodiversitas. 21(6):2681-2689. https://doi.org/10.13057/biodiv/d210641.
Mei, L.; Zhu, M.; Zhang, D. Z.; Wang, Y. Z.; Guo, J. and Zhang, H. B. 2014. Geographical and temporal changes of foliar fungal endophytes associated with the invasive plant Ageratina adenophora. Microb. Ecol. 67(2):402-409. https://doi.org/10.1007/s00248-013-0319-8.
Mondani, L.; Chiausa, G. and Battilani, P. 2021. Chemical and biological control of Fusarium species involved in garlic dry rot at early crop stages. Eur. J. Plant Pathol. 160:575-587. https://doi.org/10.1007/s10658-021-02265-0.
Munkvold, G. P. 2017. Fusarium species and their associated mycotoxins. In: Moretti, A. and Susca, A. (Eds.). Mycotoxigenic fungi. Methods in molecular biology. New York: Humana Press. 51-106 pp. https://doi.org/10.1007/978-1-4939-6707-0-4.
Munkvold, G. P. 2003. Mycotoxins in corn-occurrence, impact, and management. In: White, P. J. and Johnson, L. A. (Eds.). Corn: chemistry and technology. St. Paul: American Association of Cereal. 811-881 pp.
Murali, T. S.; Suryanarayanan, T. S. and Geeta, R. 2006. Endophytic Phomopsis species: host range and implications for diversity estimates. Can. J. Microbiol. 52(7):673-680. Doi: https://doi.org/10.1139/W06-020.
Photita, W.; Lumyong, S.; Lumyong, P. and Hyde, K. D. 2001. Endophytic fungi of wild banana (Musa acuminata) at Doi Suthep Pui National Park, Thailand. Mycol. Res. 105(12):1508-1513. https://doi.org/10.1017/S0953756201004968.
Rao, N. R. and Pavgi, M. S. 1975. Stemphylium leaf blight of onion. Mycopathologia. 56:113-118.
Ríos, M. Y.; Aguilar, G. B. A. and Navarro, V. 2003. Two new benzofuranes from Eupatorium aschembornianum and their antimicrobial activity. Planta Med. 69(10):967-970. https://doi.org/10.1055/s-2003-45113.
Rzedowski, G. C. and Rzedowsky, J. 1985. Flora fanerógamica del Valle de México. Centro Regional del Bajío. Second ed. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad (CONABIO). Pátzcuaro, Michoacán. Instituto de Ecología, AC. 450-465 pp.
Sánchez, F. R. E.; Díaz, D.; Duarte, G.; Lappe, O. P.; Sánchez, S. and Macías, R. M. L. 2015. Antifungal volatile organic compounds from the endophyte Nodulisporium sp. Strain GS4d2II1a: a qualitative change in the intraspecific and interspecific interactions with Pythium aphanidermatum. Microb. Ecol. 71(2):347-364. https://doi.org/10.1007/s00248-015-0679-3.
Sarsaiya, S.; Jain, A.; Jia, Q.; Fan, X.; Shu, F.; Chen, Z.; Zhou, Q.; Shi, J. and Chen, J. 2020. Molecular identification of endophytic fungi and their pathogenicity evaluation against Dendrobium nobile and Dendrobium officinale. Int J Mol Sci. 21(1):1-16. https://doi.org/10.3390/ijms21010316.
Schmitz, H. X.1930. Poisoned food technique. Industrial and engineering chemistry. Analyst. 2:361-363.
Sheikh, F.; Dehghani, H. and Aghajani, M. A. 2015. Screening faba bean (Vicia faba L.) genotypes for resistance to Stemphylium blight in Iran. Eur. J. Plant Pathol. 143:677-689. https://doi.org/10.1007/s10658-015-0718-4.
Sundaramoorthy, S. and Balabaskar, P. 2013. Biocontrol efficacy of Trichoderma spp. against wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici. J. Appl. Biol. Biotechnol. 1(3):36-40. https://doi.org/10.7324/JABB.2013.1306.
Wang, M. X.; Liu, F. X.; Crous, P. W. and Cai, L. X. 2017. Phylogenetic reassessment of Nigrospora: ubiquitous endophytes, plant and human pathogens. Persoonia-Mol Phylogeny Evol. Fungi. 39:118-142. https://doi.org/10.3767/persoonia.2017.39.06
White, T. J.; Bruns, T.; Lee, S. and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A.; Gelfand, D. H.; Sninsky, J. J. and White, T. J. (Eds.). PCR protocols, a guide to methods and applications. San Diego. Academic Press, Inc. 315-322 pp.
Yuen, T. K. and Hyde, K. D. and Hodgkiss, I. J. 1999. Interspecific interactions among tropical and subtropical freshwater fungi. Microb Ecol. 37(4):257-262. https://doi.org/10.1007/ s002489900151.
Zapata-Sarmiento, D. H.; Palacios-Pala, E. F.; Rodríguez-Hernández, A. A.; Medina-Melchor, D. L.; Rodríguez-Monroy, M. and Sepúlveda-Jiménez, G. 2020. Trichoderma asperellum, a potential biological control agent of Stemphylium vesicarium, on onion (Allium cepa L.). Biol. Control. 140:104105. https://doi.org/10.1016/j.biocontrol.2019.104105.
Zhang, S. X.; Xu, B. X.; Zhang, J. X. and Gan, Y. X. 2018. Identification of the antifungal activity of Trichoderma longibrachiatum T6 and assessment of bioactive substances in controlling phytopathogens. Pestic Biochem Physiol. 47:59-66. https://doi.org/10.1016/j.pestbp. 2018.02.006.