Fusarium graminearum chemotype Don in malting barley grain grown in Mexico

Fusarium head blight is a disease of great economic importance in small-grained cereals, such as barley (Hordeum vulgare L.). This disease is caused by a complex of Fusarium species, including Fusarium graminearum Schwabe [Teleomorph Gibberella zeae (Schweinitz)] (Mert-Türk et al., 2014). Gilchrist-Saavedra (2000) reported the presence of Fusarium head blight in Mexico in the regions of High Valleys and El Bajío. These regions include the states of Hidalgo, State of Mexico, Puebla, and Tlaxcala and those of Guanajuato, Jalisco, and Michoacán, where malting barley is grown under rainfed and irrigated conditions, respectively.

F. graminearum is a fungus that is characterized by producing toxins that harm the health of animals and people who consume contaminated barley grains or products (Bezerra et al., 2014; FDA, 2010), among which those of the trichothecene group stand out, such as deoxynivalenol (Don) and nivalenol (NIV) (Mert-Türk et al., 2014). These toxins are considered to be a virulence factor associated with the ability of the fungus to produce isolates with different degrees of pathogenicity (Mesterházy, 2002; Malihipour et al., 2012).

Among the recommended strategies for controlling Fusarium head blight was the use of resistant varieties to reduce the incidence of the fungus in the grain (McMullen et al., 2012). Therefore, it is necessary to have a collection of F. graminearum strains, isolated from the varieties and experimental lines of malting barley grown in the different geographical regions of Mexico, to identify sources of resistance that can be used in crosses carried out by the barley genetic improvement programs of national and international research institutions to control the disease (Bobadilla et al., 2019).

The main objective of this work was to isolate and morphologically and molecularly characterize F. graminearum isolates from different malting barley-producing regions in Mexico and to identify those strains with the greatest capacity to produce the Don toxin in vitro, for subsequent studies to search for sources of genetic resistance to Fusarium head blight.

During the 2021, 2022, and 2023 malting barley production cycles, 257 samples of spikes with and without symptoms of grain spot were collected, which were from the Adabella, Alina, Armida, Blanca, Esperanza, and Esmeralda varieties and from 131 experimental lines of the Barley Program of the National Institute of Forestry, Agricultural, and Livestock Research (INIFAP, for its acronym in Spanish). Sixty-eight samples were collected in the High Valleys region (19 in Hidalgo, 16 in Tlaxcala, 17 in the State of Mexico, and 16 in Puebla); 19 in Baja California; 156 in El Bajío (136 in Guanajuato, 12 in Jalisco, and 8 in Michoacán), and 14 in Tamaulipas. From each sample, 240 seeds were randomly taken for analysis by blotting paper and freezing (Warham et al., 1997).

Before the test, the seed was disinfested with 5% sodium hypochlorite (Reasol^MR) for 1 min in mechanical stirring and rinsed twice with sterile distilled water. Isolates with morphological characteristics of F. graminearum (Leslie and Summerell, 2006) were purified by monosporic culture in water-agar (BD Bioxon^®), cultured in water-agar-carnation leaf and potato-dextrose agar (BD Bioxon^®), and stored in mineral oil (Mier et al., 2002) and Whatman #1 filter paper (Fong et al., 2000).

DNA was extracted from each isolate from lyophilized mycelium using the cetyltrimethylammonium bromide (CTAB) method (Joint Research Centre of the European Commission, 2007). The quality and quantity of the extracted DNA was verified on a NanoDrop ND-1000. To confirm the identity and determine the chemotype by polymerase chain reaction (PCR), reactions were established with the species-specific primers Fg16N-Forward ^5´ACAGATGACAAGATTCAGGCACA^3´ and Fg16N-reverse ^5´TTCTTTGACATCTGTTCAACCCA^3´ (Nicholson et al., 1998) and with the primers ToxP1 ^5′GCCGTGGGGRTAAAAGTCAAA^3′ and ToxP2 ^5′TGACAAGTCCGGTCGCACTAGCA³, which amplify an intergenic region between the Tri5 and Tri6 genes related to the synthesis of the Don and Niv toxins (Li et al., 2005).

Each reaction had a final volume of 12 μl with the same formulation, except for annealing. Initial denaturation 95 °C, 10 min; 40 cycles: denaturation 95 °C, 30 s; annealing 60 °C, 60 s (Fg16N) or 65 °C, 60 s (ToxP); elongation 72 °C, 72 s; final elongation 72 °C, 10 min. Reactions were established on an Eppendorf Mastercycler Gradient Thermal Cycler, products were analyzed by electrophoresis in 2% agarose and visualized on a PhotoDoc-IT^TM UVP System, Fisher Scientific. As a reference, the marker ØX174 (PhiX174) /HaeIII (Fermentas and BioLabs, respectively) was included in the gel.

The PCR product with Fg16N of 21 strains was sent for sequencing to Macrogen CIA (http://dna.macrogen), Korea and the sequences were compared with Ncbi Blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to verify their relationship with Fusarium graminearum. The ability of the isolates to produce Don in vitro was evaluated by the Ridascreen^® Fast Don test (enzyme immunoassay (Elisa)) using flour samples (2 g) obtained from rice grains (Sos^® Sushi Rice, super extra) colonized with the fungus, and with Ridascreen^® Fast Don plates, reagents, and protocol.

The data were analyzed with the Statistical Analysis Software (SAS) Version 9.4, for Windows, under a completely randomized design, and the comparison of means by Tukey’s method (α= 0.05). Of the total number of seeds (61 680 seeds) analyzed from High Valleys, El Bajío, and Tamaulipas, 39 isolates with morphological characteristics of F. graminearum were obtained (Leslie and Summerell, 2006) (Table 1).

The fungus was not isolated from the seeds from Baja California and Michoacán. Except for JA1, all isolates amplified the expected band of 280 base pairs (bp) with Fg16N-F/Fg16N-R (Nicholson et al., 1998). The sequences (approximately 250 bp) of the product with Fg16N of 21 strains (randomly taken by locality), including that of JA1, annealed with the sequence of chromosome 1 of F. graminearum, accession number HG970332, deposited in the GenBank-NCBI database (Table 1). The similarity rates were between 99 and 96%.

In the reaction with ToxP1/ToxP2, 17 isolates from High Valleys (14), Jalisco (1), and Tamaulipas (2) amplified a 300 bp band (Table 1). It is important to note that these primers simultaneously detect two fragments: a 300 bp fragment for the Don-producing chemotype of F. graminearum and a 360 bp fragment for the NIV-producing chemotype of F. graminearum (Li et al., 2005). No isolate of Guanajuato was amplified by these primers. Except for NA11R30, 10 of the isolates that amplified with ToxP1/ToxP2 recorded Don production in vitro, with differences (Tukey α= 0.05) in production levels.

Possibly, the isolates that amplified with Fg16N, but did not amplify with ToxP or record Don production, correspond to other chemotypes of F. graminearum (Walker et al., 2001).

In general, the results indicate that, in the malting barley-producing regions of High Valleys, El Bajío, Baja California, and Tamaulipas, the incidence of F. graminearum was low (less than 1%), and that the 39 isolates obtained show genetic variation (Tukey α= 0.05) not only among the isolates from different states, but also among the isolates in collections from the same municipality (Table 1). Cerón-Bustamante et al. (2018) research did not detect F. graminearum among the Fusarium species associated with wheat spikes with Fusarium head blight collected in the wheat-producing regions of High Valleys, El Bajío and Oaxaca.